eprimer3 is an interface to the
primer3 program from the Whitehead Institute.
The Whitehead program must be set up and on the path in order for
eprimer3 to find and run it.
eprimer3 picks primers for PCR reactions,
considering as criteria:
Oligonucleotide melting temperature, size, GC content, and
primer-dimer possibilities.
PCR product size.
Positional constraints within the source sequence.
Other miscellaneous constraints.
Here is a sample session with eprimer3:
% eprimer3 em:hsfau1 hsfau.eprimer3 -explain
Mandatory qualifiers:
- [-sequence] (seqall)
-
The sequence from which to choose primers. The sequence must be
presented 5' to 3'.
- [-outfile] (outfile)
-
Output filename.
Optional qualifiers (bold if not always prompted):
- -task (menu)
-
Tell eprimer3 what task to perform. Legal values
are:
- 0
Pick PCR primer.
- 1
Pick PCR primers and hybridization probe.
- 2
Pick forward primer only.
- 3
Pick reverse primer only.
- 4
Pick hybridization probe only.
The tasks should be self explanatory. Briefly, an internal oligo is
intended to be used as a hybridization probe (hyb probe) to detect
the PCR product after amplification.
- -numreturn (integer)
-
The maximum number of primer pairs to return. Primer pairs returned
are sorted by their quality, in other words, by the value of the
objective function (where a lower number indicates a better primer
pair). Note that setting this parameter to a large value will
increase running time.
- -includedregion (range)
-
A subregion of the given sequence from which to pick primers. For
example, the first dozen or so bases of a sequence are often vector
and should be excluded from consideration. The value for this
parameter has the form
start,end
where start is the index of the first base to
consider and end is the last in the primer-picking
region.
- -target (range)
-
If one or more Targets are specified, a legal primer pair must flank
at least one of them. A Target might be a simple sequence repeat site
(for example, a CA repeat) or a single-base-pair polymorphism. The
value should be a space-separated list of
start,end
pairs where start is the index of the first base
of a Target, and end is the last. E.g.,
50,51 requires primers to surround the 2 bases at
positions 50 and 51.
- -excludedregion (range)
-
Primer oligos may not overlap any region specified in this tag. The
associated value must be a space-separated list of
start,end
pairs where start is the index of the first base
of the excluded region, and end is the last. This
tag is useful for tasks such as excluding regions of low sequence
quality or excluding regions containing repetitive elements such as
ALUs or LINEs. E.g., 401,407 68,70 forbids
selection of primers in the 7 bases starting at 401 and the 3 bases
at 68.
- -forwardinput (string)
-
The sequence of a forward primer to check, then use to design reverse
primers and optional internal oligos. Must be a substring of
SEQUENCE.
- -reverseinput (string)
-
The sequence of a reverse primer to check and use to design forward
primers and optional internal oligos. Must be a substring of the
reverse strand of SEQUENCE.
- -gcclamp (integer)
-
Require the specified number of consecutive Gs and Cs at the
3' end of both the forward and reverse primer. (This
parameter has no effect on the internal oligo if one is requested.)
- -osize (integer)
-
Optimum length (in bases) of a primer oligo. EPrimer3 attempts to
pick primers close to this length.
- -minsize (integer)
-
Minimum acceptable length of a primer. Must be greater than 0 and
less than or equal to MAX-SIZE.
- -maxsize (integer)
-
Maximum acceptable length (in bases) of a primer. Currently, this
parameter cannot be larger than 35. This limit is governed by the
maximum oligo size for which EPrimer3's
melting-temperature is valid.
- -otm (float)
-
Optimum melting temperature (Celsius) for a primer oligo. EPrimer3
will try to pick primers with melting temperatures close to this
temperature. The oligo melting temperature formula in EPrimer3 is
given in Rychlik, Spencer and Rhoads, Nucleic Acids
Research, Volume 18:12, pages 6409-6412 and Breslauer,
Frank, Bloeker and Marky, Proceedings of the National
Academy of Sciences USA, vol 83, pp 3746-3750. Please
refer to the former paper for background discussion.
- -mintm (float)
-
Minimum acceptable melting temperature (Celsius) for a primer oligo.
- -maxtm (float)
-
Maximum acceptable melting temperature (Celsius) for a primer oligo.
- -maxdifftm (float)
-
Maximum acceptable (unsigned) difference between the melting
temperatures of the forward and reverse primers.
- -ogcpercent (float)
-
Primer optimum GC percent.
- -mingc (float)
-
Minimum allowable percentage of Gs and Cs in any primer.
- -maxgc (float)
-
Maximum allowable percentage of Gs and Cs in any primer generated by
Primer.
- -saltconc (float)
-
The millimolar concentration of salt (usually KCl) in the PCR.
EPrimer3 uses this argument to calculate oligo melting temperatures.
- -dnaconc (float)
-
The nanomolar concentration of annealing oligos in the PCR. EPrimer3
uses this argument to calculate oligo melting temperatures. The
default (50nM) works well with the standard protocol used at the
Whitehead/MIT Center for Genome Research—0.5 microliters of 20
micromolar concentration for each primer oligo in a 20 microliter
reaction with 10 nanograms template, 0.025 units/microliter Taq
polymerase in 0.1 mM each dNTP, 1.5mM MgCl2,
50mM KCl, 10mM Tris-HCl (pH 9.3) using 35 cycles with an annealing
temperature of 56 degrees Celsius. This parameter corresponds to
"c" in Rychlik, Spencer and
Rhoads' equation (ii) (Nucleic Acids
Research, vol 18, num 12) where a suitable value (for a
lower initial concentration of template) is
"empirically determined". The value
of this parameter is less than the actual concentration of oligos in
the reaction because it is the concentration of annealing oligos,
which in turn depends on the amount of template (including PCR
product) in a given cycle. This concentration increases a great deal
during a PCR; fortunately PCR seems quite robust for a variety of
oligo melting temperatures.
- -maxpolyx (integer)
-
The maximum allowable length of a mononucleotide repeat in a primer,
for example AAAAAA.
- -productosize (integer)
-
The optimum size for the PCR product. 0 indicates
that there is no optimum product size.
- -productsizerange (range)
-
The associated values specify the lengths of the product that the
user wants the primers to create, and is a space separated list of
elements of the form
x-y
where this pair is a legal range of lengths for the product. For
example, if you want PCR products to be between 100 to 150 bases
(inclusive), set this parameter to 100-150. If you
desire PCR products in either the range from 100 to 150 bases or in
the range from 200 to 250 bases, set this parameter to
100-150 200-250. EPrimer3 favors ranges to the
left side of the parameter string. EPrimer3 will return legal primers
pairs in the first range regardless the value of the objective
function for these pairs. EPrimer3 returns primers in a subsequent
range only if there is an insufficient number of primers in the first
range.
- -productotm (float)
-
The optimum melting temperature for the PCR product.
0 indicates that there is no optimum temperature.
- -productmintm (float)
-
The minimum allowed melting temperature of the amplicon. Please see
the documentation on the maximum melting temperature of the product
for details.
- -productmaxtm (float)
-
The maximum allowed melting temperature of the amplicon. Product Tm
is calculated using the formula from Bolton and McCarthy,
Proceedings of the National Academy of Sciences
84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis,
Molecular Cloning, p 11.46 (1989, CSHL Press).
Tm = 81.5 +
16.6(log10([Na+]))
+ .41*(%GC) - 600/length where [Na+} is
the molar sodium concentration, (%GC) is the percent of Gs and Cs in
the sequence, and length is the length of the sequence. A similar
formula is used by the prime primer selection program in GCG
(http://www.gcg.com), which
instead uses 675.0/length in the last term (after F. Baldino, Jr,
M.-F. Chesselet, and M.E. Lewis, Methods in
Enzymology 168:766 (1989) eqn (1) on page 766 without the
mismatch and formamide terms). The formulas here and in Baldino et
al. assume Na+ rather than
K+. According to J.G. Wetmur, Critical
Reviews in Biochemistry and and Molecular Biology 26:227 (1991) 50 mM
K+ should be equivalent in these formulae
to .2 M Na+. EPrimer3 uses the same salt
concentration value for calculating both the primer melting
temperature and the oligo melting temperature. If you plan to later
use the PCR product for hybridization, this behavior will not give
you the Tm under hybridization conditions.
- -oligoexcludedregion (range)
-
Middle oligos may not overlap any region specified by this tag. The
associated value must be a space-separated list of
start,end
pairs, where start is the index of the
first base of an excluded region, and end
is the last. Often one would make Target regions excluded regions for
internal oligos.
- -oligoinput (string)
-
The sequence of an internal oligo to check, then use to design
forward and reverse primers. Must be a substring of SEQUENCE.
- -oligoosize (integer)
-
Optimum length (in bases) of an internal oligo. EPrimer3 will attempt
to pick primers close to this length.
- -oligominsize (integer)
-
Minimum acceptable length of an internal oligo. Must be greater than
0 and less than or equal to
INTERNAL-OLIGO-MAX-SIZE.
- -oligomaxsize (integer)
-
Maximum acceptable length (in bases) of an internal oligo. Currently,
this parameter cannot be larger than 35. This
limit is governed by maximum oligo size for which
EPrimer3's melting temperature is valid.
- -oligootm (float)
-
Optimum melting temperature (Celsius) for an internal oligo. EPrimer3
tries to pick oligos with melting temperatures close to this
temperature. The oligo melting temperature formula in EPrimer3 is
that given in Rychlik, Spencer and Rhoads, Nucleic Acids
Research, vol 18, num 12, pp 6409-6412 and Breslauer,
Frank, Bloeker and Marky, Procedures of the National
Academy of Sciences USA, vol 83, pp 3746-3750. Please
refer to the former paper for background discussion.
- -oligomintm (float)
-
Minimum acceptable melting temperature (Celsius) for an internal
oligo.
- -oligomaxtm (float)
-
Maximum acceptable melting temperature (Celsius) for an internal
oligo.
- -oligoogcpercent (float)
-
Internal oligo optimum GC percent.
- -oligomingc (float)
-
Minimum allowable percentage of Gs and Cs in an internal oligo.
- -oligomaxgc (float)
-
Maximum allowable percentage of Gs and Cs in any internal oligo
generated by Primer.
- -oligosaltconc (float)
-
The millimolar concentration of salt (usually KCl) in the
hybridization. EPrimer3 uses this argument to calculate internal
oligo melting temperatures.
- -oligodnaconc (float)
-
The nanomolar concentration of annealing internal oligo in the
hybridization.
- -oligoselfany (float)
-
The maximum allowable local alignment score when testing an internal
oligo for (local) self-complementarity. Local self-complementarity is
taken to predict the tendency of oligos to anneal to themselves. The
scoring system gives 1.00 for complementary bases, -0.25 for a match
of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a
gap. Only single-base-pair gaps are allowed. For example, the
alignment:
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment:
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00
indicates that there is no reasonable local alignment between two
oligos.
- -oligoselfend (float)
-
The maximum allowable 3'-anchored global alignment score when testing
a single oligo for self-complementarity. The scoring system is as for
the Maximum Complementarity argument. In the examples above the
scores are 7.00 and 6.00 respectively. Scores are non-negative, and a
score of 0.00 indicates that there is no reasonable 3'-anchored
global alignment between two oligos. In order to estimate 3'-anchored
global alignments for candidate oligos, Primer assumes that the
sequence from which to choose oligos is presented 5'
to 3'. INTERNAL-OLIGO-SELF-END is
meaningless when applied to internal oligos used for
hybridization-based detection, since primer-dimer will not occur. We
recommend that INTERNAL-OLIGO-SELF-END be set at
least as high as INTERNAL-OLIGO-SELF-ANY.
- -oligomaxpolyx (integer)
-
The maximum allowable length of an internal oligo mononucleotide
repeat. For example, AAAAAA.
Advanced qualifiers:
- -explainflag (boolean)
-
If this flag is nonzero, produce LEFT-EXPLAIN,
RIGHT-EXPLAIN, and
INTERNAL-OLIGO-EXPLAIN output tags, which provide
information on the number of oligos and primer pairs examined by
EPrimer3. These tags also provide statistics on the number discarded
and the reasons for these discards.
- -fileflag (boolean)
-
If the associated value is nonzero, EPrimer3 creates two output files
for each input SEQUENCE. File
sequence-id.for lists
all acceptable forward primers for
sequence-id, and
sequence-id.rev lists
all acceptable reverse primers for
sequence-id, where
sequence-id is the value of the
SEQUENCE-ID tag (which must be supplied). In
addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file
sequence-id.int,
which lists all acceptable internal oligos.
- -firstbaseindex (integer)
-
This parameter is the index of the first base in the input sequence.
For input and output using 1-based indexing (the method GenBank
uses), set this parameter to 1. For input and output using 0-based
indexing, set this parameter to 0. (This parameter
also affects the indexes in the contents of the files produced when
the primer file flag is set.)
- -pickanyway (boolean)
-
If true, pick a primer pair—even if
LEFT-INPUT, RIGHT-INPUT, or
INTERNAL-OLIGO-INPUT violate specific constraints.
- -mispriminglibrary (infile)
-
The name of a file containing a nucleotide sequence library of
sequences to avoid amplifying. For example, repetitive sequences or
the sequences of genes in a gene family that should not be amplified
are often put into this file. The file must be in (a slightly
restricted) FASTA format (W. B. Pearson and D.J. Lipman,
PNAS 85:8 pp 2444-2448 [1988]); we briefly
discuss the organization of this file below. If this parameter is
specified, EPrimer3 locally aligns each candidate primer against each
library sequence and rejects those primers for which the local
alignment score times a specified weight (see below) exceeds
MAX-MISPRIMING. (The maximum value of the weight
is arbitrarily set to 100.0.) Each sequence entry
in the FASTA format file must begin with an id line that starts with
">". The contents of the id line
is slightly restricted in that EPrimer3 parses everything after any
optional asterisk (`*') as a
floating point number to use as the weight mentioned previously. If
the id line contains no asterisk, the weight defaults to 1.0. The
alignment scoring system used is the same as for calculating
complementarity among oligos (e.g., SELF-ANY). The remainder of an
entry contains the sequence as lines following the id line up until a
line starting with ">" or the
end of the file. Whitespace and newlines are ignored. Characters
"A",
"T",
"G",
"C'",
"a",
"t",
"g",
"c" are retained. Any other
character is converted to "N"
(meaning that any IUB/IUPAC codes for ambiguous bases are converted
to "N"). There are no restrictions
on line length. An empty value for this parameter indicates that no
repeat library should be used.
- -maxmispriming (float)
-
The maximum allowed weighted similarity with any sequence in
MISPRIMING-LIBRARY.
- -pairmaxmispriming (float)
-
The maximum allowed sum of weighted similarities of a primer pair
(one similarity for each primer) with any single sequence in
MISPRIMING-LIBRARY.
- -numnsaccepted (integer)
-
Maximum number of unknown bases N allowable in any
primer.
- -selfany (float)
-
The maximum allowable local alignment score when testing a single
primer for (local) self-complementarity, and the maximumallowable
local alignment score when testing for complementarity between
forward and reverse primers. Local self-complementarity is taken to
predict the tendency of primers to anneal to each other without
necessarily causing self-priming in the PCR. The scoring system gives
1.00 for complementary bases, -0.25 for a match of any base (or N)
with an N, -1.00 for a mismatch, and -2.00 for a gap. Only
single-base-pair gaps are allowed. For example, the alignment:
5' ATCGNA 3'
...|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment:
5' ATCCGNA 3'
...|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00
indicates that there is no reasonable local alignment between two
oligos.
- -selfend (float)
-
The maximum allowable 3'-anchored global alignment score when testing
a single primer for self-complementarity, and the maximum allowable
3'-anchored global alignment score when testing for complementarity
between forward and reverse primers. The 3'-anchored global alignment
score is taken to predict the likelihood of PCR-priming
primer-dimers, for example:
5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||..........
3' AAGTCCTACATTTAGCCTAGT 5'
or:
5' AGGCTATGGGCCTCGCGA 3'
...............||||||............
3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum Complementarity argument. In
the previous examples, the scores are 7.00 and 6.00, respectively.
Scores are non-negative, and a score of 0.00 indicates that there is
no reasonable 3'-anchored global alignment between two oligos. In
order to estimate 3'-anchored global alignments for candidate primers
and primer pairs, Primer assumes that the sequence from which to
choose primers is presented 5' to
3'. It is nonsensical to provide a larger value for
this parameter than that given for the Maximum (local)
Complementarity parameter because the score of a local alignment will
always be at least as great as the score of a global alignment.
- -maxendstability (float)
-
The maximum stability for the five 3' bases of a
forward or reverse primer. Bigger numbers mean more stable
3' ends. The value is the maximum delta G for duplex
disruption for the five 3' bases as calculated using
the nearest neighbor parameters published in Breslauer, Frank,
Bloeker and Marky, Proceedings of the National Academy of
Sciences, vol 83, pp 3746-3750. EPrimer3 uses a completely
permissive default value for backward compatibility (which we may
change in the next release). Rychlik recommends a maximum value of 9
(Wojciech Rychlik, "Selection of Primers for
Polymerase Chain Reaction" in BA White, Ed.,
Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and Applications, 1993, pp 31-40, Humana
Press, Totowa NJ).
- -oligomishyblibrary (infile)
-
Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid
is hybridization of the internal oligo to sequences in this library
rather than priming from them. The file must be in (a slightly
restricted) FASTA format (W. B. Pearson and D.J. Lipman,
Proceedings of the National Academy fo Sciences
85:8 pp 2444-2448 [1988]); we briefly discuss the organization of
this file below. If this parameter is specified, EPrimer3 locally
aligns each candidate oligo against each library sequence and rejects
those primers for which the local alignment score times a specified
weight exceeds INTERNAL-OLIGO-MAX-MISHYB. (The
maximum value of the weight is arbitrarily set to 12.0.) Each
sequence entry in the FASTA-format file must begin with an id line
that starts with ">". The
contents of the id line is slightly restricted in that EPrimer3
parses everything after any optional asterisk
(`*') as a floating point number to
use as the weight mentioned above. If the id line contains no
asterisk, the weight defaults to 1.0. The alignment scoring system
used is the same as for calculating complementarity among oligos
(e.g., SELF-ANY). The remainder of an entry
contains the sequence as lines following the id line up until a line
starting with ">" or the end of
the file. Whitespace and newlines are ignored. Characters
"A",
"T",
"G",
"C'",
"a",
"t",
"g", and
"c" are retained and any other
character is converted to "N"
(meaning that any IUB / IUPAC codes for ambiguous bases are converted
to "N"). There are no restrictions
on line length. An empty value for this parameter indicates that no
library should be used.
- -oligomaxmishyb (float)
-
Similar to MAX-MISPRIMING, except this parameter
applies to the similarity of candidate internal oligos to the library
specified in
INTERNAL-OLIGO-MISHYB-LIBRARY.
|